Prev. | 

RIKEN DNA Bank Human Resource - FIG4

Gene ID NCBI Gene 9896 |  KEGG hsa:9896
Gene Symbol FIG4
Protein Name FIG4 phosphoinositide 5-phosphatase
Synonyms ALS11|BTOP|CMT4J|KIAA0274|SAC3|YVS|dJ249I4.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030139 IRAK075F19 pBluescriptR BC041338 NM_014845 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080420 M01C001A20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080468 M01C001C20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080516 M01C001E20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080564 M01C001G20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080612 M01C001I20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080660 M01C001K20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080708 M01C001M20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE080756 M01C001O20 pDONR221 04-134-2_1-B10 BC041338 NM_014845  
HGE090819 M01C027A19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE090867 M01C027C19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE090915 M01C027E19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE090963 M01C027G19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE091011 M01C027I19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE091059 M01C027K19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE091107 M01C027M19 pDONR221 MGC03-A10 BC041338 NM_014845  
HGE091155 M01C027O19 pDONR221 MGC03-A10 BC041338 NM_014845  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040460 ARe01C12 pKA1U5 NM_014845.5  
GAGTGCCTAATGGGTGTTGTTCCTGGCTGGACTTGATGTCCAGGGCCTGAGGGGTTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl