Prev. |  KEGG KO K14409 > 

RIKEN DNA Bank Human Resource - SMG7

Gene ID NCBI Gene 9887 |  KEGG hsa:9887
Gene Symbol SMG7
Protein Name SMG7 nonsense mediated mRNA decay factor
Synonyms C1orf16|EST1C|SGA56M
Ortholog resource in our bank

  SMG7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018852 IRAK047C04 pBluescriptR BC036381 NM_201569 Partial/var
HGY088194 IRAL020I02 pOTB7 BC009281 NM_201569
HGY099053 IRAL047K13 pOTB7 BC052565 NM_201569 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395674 RBd89D02 pGCAP10 NM_173156.1  
GGAGGAGCCGGAGGAGAGGAAGATGGCGGCGGCCGCCAGCACCCGCGGTGCCGCGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl