Prev. |  KEGG KO K20174 > 

RIKEN DNA Bank Human Resource - OSBPL2

Gene ID NCBI Gene 9885 |  KEGG hsa:9885
Gene Symbol OSBPL2
Protein Name oxysterol binding protein like 2
Synonyms DFNA67|DNFA67|ORP-2|ORP2
Ortholog resource in our bank

  OSBPL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083799 IRAL009I07 pOTB7 BC004455 NM_144498 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048928 ARe22F08 pKA1U5 NM_144498.1  
GGGGGCGGCAGTGAGCTCGGCCGGCAACCGAGGGACCCGCGNTCCAGATCTTCAGTGTCT
HKR347728 RBb69F08 pGCAP1 NM_144498.1  
GAGGGGGCGGGGGCGGGGCGGCAGTGAGCTCGGCCGGCAACCGAGGGACCCGCGTCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl