Prev. |  KEGG KO K14316 > 

RIKEN DNA Bank Human Resource - POM121

Gene ID NCBI Gene 9883 |  KEGG hsa:9883
Gene Symbol POM121
Protein Name POM121 transmembrane nucleoporin
Synonyms P145|POM121A
Ortholog resource in our bank

  POM121

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081273 IRAL003D01 pOTB7 BC001518 NM_172020 Partial
HGY085133 IRAL012N21 pOTB7 BC008794 NM_172020 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE122431 M01C106B07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122479 M01C106D07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122527 M01C106F07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122575 M01C106H07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122623 M01C106J07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122671 M01C106L07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122719 M01C106N07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE122767 M01C106P07 pDONR221 06_13-G04 BC008794 NM_172020  
HGE125633 M01C114B09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125681 M01C114D09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125729 M01C114F09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125777 M01C114H09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125825 M01C114J09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125873 M01C114L09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125921 M01C114N09 pDONR221 06-2_05-G05 BC008794 NM_172020  
HGE125969 M01C114P09 pDONR221 06-2_05-G05 BC008794 NM_172020  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015705 W01A039E09 pENTR-TOPO flj0032o05 AK022555 NM_172020  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR020106 ARa50E10 pKA1U5 NM_172020.1  
GGCTCTCGTTCCCAGGCTTTGGCCTCTAGTGGACGAGAATNACCGAGTCTGCGGGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl