Prev. |  KEGG KO K12811 > 

RIKEN DNA Bank Human Resource - DDX46

Gene ID NCBI Gene 9879 |  KEGG hsa:9879
Gene Symbol DDX46
Protein Name DEAD-box helicase 46
Synonyms PRPF5|Prp5
Ortholog resource in our bank

  DDX46

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005529 IRAK013N17 pCMV-SPORT6 BC012304 NM_014829 Full
HGY028124 IRAK070F04 pBluescriptR BC030755 NM_014829 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060050 ARe50C02 pKA1U5 NM_014829.2  
GCTGTTTTCGTTGGCCGCGCTGGGATGGCCGCCACAGCTGTAGGTGCTGCTAGNTGTTTA
HKR170035 ARi25B11 pGCAP10 NM_014829.2  
GTTTTCGTTGGCCGCGCTGGGATGGCCGCCACAGCTGTAGGTGCTGCTAGTGTTTAGCGC
HKR362547 RBd06G03 pGCAP10 NM_014829.2  
GTGGGATGGCCGCCACAGCTGTAGGTGCTGCTAGTGTTTAGCGCTGGTCTTTGCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl