Prev. | 

RIKEN DNA Bank Human Resource - ZC3H11A

Gene ID NCBI Gene 9877 |  KEGG hsa:9877
Gene Symbol ZC3H11A
Protein Name zinc finger CCCH-type containing 11A
Synonyms ZC3HDC11A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029353 IRAK073G09 pBluescriptR BC038513 NM_014827 Full/var
HGX037285 IRAK093D13 pCMV-SPORT6 BC048271 NM_014827 Partial/var
HGY085718 IRAL014E22 pOTB7 BC014268 NM_014827 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180122 ARi50F02 pGCAP10 NM_014827.4  
GAGTCTTGGTTTTTTGCTAGTGCTGCTGCTGCTGGGAGGACGACGGACGGCAGCGGCCAA
HKR362505 RBd06E09 pGCAP10 NM_014827.4  
GGTAGCCAGGCGCCATCTTTGACGCTGGCAGTCTTGGTTTTCTGCTAGTGCTGCTGCTGC
HKR384974 RBd62H06 pGCAP10 NM_014827.4  
GAGTGCTGCTGCTGCTGGGAGGACGACGGACGGCAGCGGCCAAGCAAGAAGAAAGACGTG
HKR394459 RBd86C11 pGCAP10 NM_014827.4  
GAGTGCCGGTGGTGCTGGCACCACGAAGGGCGGTTACTATTACCAAGCTTAAAGACGTGC
HKR432560 RBdS081G16 pGCAP10 NM_014827.4  
GAGTCTTGGTTTTCTGCTNGTGCTGCTGCTGCTGGGAGGACGACGGACGGCAGCGGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl