RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SETDB1

Gene ID	NCBI Gene 9869 \| KEGG hsa:9869
Gene Symbol	SETDB1
Protein Name	SET domain bifurcated histone lysine methyltransferase 1
Synonyms	ESET\|H3-K9-HMTase4\|KG1T\|KMT1E\|TDRD21
Featured content	Signaling pathways regulating pluripotency of stem cells (human)

Ortholog resource in our bank

  SETDB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY090372	IRAL025P12	pOTB7	BC028671	NM_012432

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR018849	ARa47C01	pKA1U5	NM_012432.3
HKR018849	GGCTTCCCCTTCCCTCTTTCACGCTTCCTCCCCTCCCCCTCCTCCCTTATCCCTTCGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl