Prev. |  KEGG KO K11421 > 

RIKEN DNA Bank Human Resource - SETDB1

Gene ID NCBI Gene 9869 |  KEGG hsa:9869
Gene Symbol SETDB1
Protein Name SET domain bifurcated 1
Synonyms ESET|H3-K9-HMTase4|KG1T|KMT1E|TDRD21
Ortholog resources KEGG ortholog (KEGG orthology K11421) in the DNA Bank
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090372 IRAL025P12 pOTB7 BC028671 NM_012432

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR018849 ARa47C01 pKA1U5 NM_012432.3  
GGCTTCCCCTTCCCTCTTTCACGCTTCCTCCCCTCCCCCTCCTCCCTTATCCCTTCGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl