Prev. |  KEGG KO K03037 > 

RIKEN DNA Bank Human Resource - PSMD6

Gene ID NCBI Gene 9861 |  KEGG hsa:9861
Gene Symbol PSMD6
Protein Name proteasome 26S subunit, non-ATPase 6
Synonyms Rpn7|S10|SGA-113M|p42A|p44S10
Ortholog resources KEGG ortholog (KEGG orthology K03037) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001221 IRAK003A21 pCMV-SPORT6 BC000904 NM_014814 Full
HGX008456 IRAK021C08 pCMV-SPORT6 BC012369 NM_014814 Full
HGY082043 IRAL005B19 pOTB7 BC000630 NM_014814 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006420 W01A016A20 pENTR-TOPO IRAK021C08 BC012369 NM_014814  
HGE006424 W01A016A24 pENTR-TOPO IRAK021C08 BC012369 NM_014814  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR069649 ARe74C01 pKA1U5 NM_014814.1  
GGGTCGTAACCAAGTTGTGTCCTGTCAGCCGCTGTCCCCTTCGCCGCGATGCCGCTGGAG
HKR165753 ARi14G09 pGCAP10 NM_014814.1  
GGTAACCAAGTTGTGTCCTGTCAGCCGCTGTCCCCTTCGCCGCGATGCCGCTGGAGAACC
HKR279398 ARiS198I06 pGCAP10 NM_014814.1  
GCCCTNNNGCCGCGNNGCCGCNGGAGAACCTGGAGGAGGAGGGTCTGCCCAAGAACCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl