Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF623

Gene ID NCBI Gene 9831 |  KEGG hsa:9831
Gene Symbol ZNF623
Protein Name zinc finger protein 623
Synonyms -
Ortholog resource in our bank

  ZNF623

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY068986 IRAK172H18 pDNR-Dual BC067516 NM_014789 Full
HGY068987 IRAK172H19 pDNR-Dual BC067517 NM_014789 Full
HGY068989 IRAK172H21 pDNR-Dual BC067518 NM_014789 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035564 W01A088P04 pENTR-TOPO IRAK172H18 BC067516 NM_014789  
HGE035570 W01A088P10 pENTR-TOPO IRAK172H18 BC067516 NM_014789  
HGE035576 W01A088P16 pENTR-TOPO IRAK172H18 BC067516 NM_014789  
HGE035578 W01A088P18 pENTR-TOPO IRAK172H18 BC067516 NM_014789  
HGE035582 W01A088P22 pENTR-TOPO IRAK172H18 BC067516 NM_014789  
HGE035584 W01A088P24 pENTR-TOPO IRAK172H18 BC067516 NM_014789  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372952 RBd32G08 pGCAP10 NM_014789.3  
GGGCGGCGGTGCAGGCTTTGTCGGCTGATCTGTGGGGCCCGCGCCCGCGGGGTCCAGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl