Prev. |  KEGG KO K10613 > 

RIKEN DNA Bank Human Resource - CUL7

Gene ID NCBI Gene 9820 |  KEGG hsa:9820
Gene Symbol CUL7
Protein Name cullin 7
Synonyms 3M1|CUL-7|KIAA0076|dJ20C7.5
Ortholog resource in our bank

  CUL7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027954 IRAK069O18 pCMV-SPORT6 BC033647 NM_014780 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094031 M01C035B07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094079 M01C035D07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094127 M01C035F07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094175 M01C035H07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094223 M01C035J07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094271 M01C035L07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094319 M01C035N07 pDONR221 MGC07-C04 BC033647 NM_014780  
HGE094367 M01C035P07 pDONR221 MGC07-C04 BC033647 NM_014780  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017022 W01A042J06 pENTR-TOPO IRAK069O18 BC033647 NM_014780  
HGE017024 W01A042J08 pENTR-TOPO IRAK069O18 BC033647 NM_014780  
HGE017036 W01A042J20 pENTR-TOPO IRAK069O18 BC033647 NM_014780  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048574 ARe21H06 pKA1U5 NM_014780.3  
GGCTTTCCGCTGGGTCGGGCGGAAATGAGCCGTGGCTTTTGGCTGGCGGAGCCGCTGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl