Prev. |  KEGG KO K10456 > 

RIKEN DNA Bank Human Resource - KEAP1

Gene ID NCBI Gene 9817 |  KEGG hsa:9817
Gene Symbol KEAP1
Protein Name kelch like ECH associated protein 1
Synonyms INrf2|KLHL19
Ortholog resource in our bank

  KEAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14133 pIDT-SMART(C-TSC)-HA-hKEAP1 Expression vector of N-terminal HA-tagged human KEAP1.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006179 IRAK015H11 pCMV-SPORT6 BC015945 NM_203500 Full
HGY082067 IRAL005C19 pOTB7 BC002417 NM_203500 Full
HGY083632 IRAL009B08 pOTB7 BC021957 NM_203500 Partial
HGY086208 IRAL015I16 pOTB7 BC002930 NM_203500 Full
HGY092155 IRAL030G11 pOTB7 BC014118 NM_203500 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009608 W01A024A08 pENTR-TOPO IRAL005C19 BC002417 NM_203500  
HGE009612 W01A024A12 pENTR-TOPO IRAL005C19 BC002417 NM_203500  
HGE009616 W01A024A16 pENTR-TOPO IRAL005C19 BC002417 NM_203500  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219630 ARiS049B06 pGCAP10 NM_012289.3  
GCCTTTTCGGGCGTCCCGAGGCCGCTCCCCAACCGACAACCAAGACCCCGCAGGCCACTC
HKR376884 RBd42D12 pGCAP10 NM_012289.3  
GGCGGAGCCGGAGCGCGGCCATGGCGGGGTCCCTGAGTGCCAGAGGTGGTGGTGTTGCTT
HKR388532 RBd71F12 pGCAP10 NM_012289.3  
GGGAGCGCGGCCATGGCGGGGTCCCTGAGTGCCAGAGGTGGTGGTGTTGCTTATCTTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.15

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl