Prev. |  KEGG KO K12487 > 

RIKEN DNA Bank Human Resource - GIT2

Gene ID NCBI Gene 9815 |  KEGG hsa:9815
Gene Symbol GIT2
Protein Name GIT ArfGAP 2
Synonyms CAT-2|CAT2|PKL
Featured content Endocytosis (human)
Ortholog resource in our bank

  GIT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031239 IRAK078B15 pCMV-SPORT6 BC039880 NM_139201 Partial/var
HGY081803 IRAL004I11 pOTB7 BC001379 NM_139201 Full
HGY092076 IRAL030D04 pOTB7 BC014223 NM_139201 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050033 ARe25B09 pKA1U5 NM_057169.3  
GAGCGCCGCCGCAGCTGGGACCCGTTAGAGCGGAAGCGCCGCCGCCACCGCCGCCTTTGC
HKR264732 ARiS161N20 pGCAP10 NM_057169.3  
GGCTGCAAGGCGCTGAGGGNAGAGGTTTTNNNATNACNTTNNNANANNTGNNAANNNGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl