Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GIT2

Gene ID (NCBI) 9815
Gene Symbol GIT2
Protein Name G protein-coupled receptor kinase interacting ArfGAP 2
Synonyms CAT-2|CAT2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX031239 IRAK078B15 pCMV-SPORT6 BC039880 NM_139201 Partial/var
HGY081803 IRAL004I11 pOTB7 BC001379 NM_139201 Full
HGY092076 IRAL030D04 pOTB7 BC014223 NM_139201 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050033 ARe25B09 pKA1U5 NM_057169.3  
GAGCGCCGCCGCAGCTGGGACCCGTTAGAGCGGAAGCGCCGCCGCCACCGCCGCCTTTGC
HKR264732 ARiS161N20 pGCAP10 NM_057169.3  
GGCTGCAAGGCGCTGAGGGNAGAGGTTTTNNNATNACNTTNNNANANNTGNNAANNNGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl