Prev. | 

RIKEN DNA Bank Human Resource - DAZAP2

Gene ID NCBI Gene 9802 |  KEGG hsa:9802
Gene Symbol DAZAP2
Protein Name DAZ associated protein 2
Synonyms PRTB
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082932 IRAL007F12 pOTB7 BC002334 NM_014764
HGY088225 IRAL020J09 pOTB7 BC007900 NM_014764 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046251 W01A115K11 pENTR-TOPO IRAL007F12 BC002334 NM_014764  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059701 ARe49E05 pKA1U5 NM_014764.2  
GCCGCGACGCCGAGACAAACCGGACCCGCAACCACCATGTAACAGCAAAGGTCAATATCC
HKR219963 ARiS049P03 pGCAP10 NM_014764.2  
GAAACCGGACCCGCAACCACCATGAACAGCAAAGGTCAATATCCAACACAGCCAACCTAC
HKR277814 ARiS194I22 pGCAP10 NM_014764.2  
GGACACGGAAGTAGCTCCGAACAGGAAGAGGACGAAAAAAATAACCGTCCGCGACGCCGA
HKR277967 ARiS194P07 pGCAP10 NM_014764.2  
GGACACGGAAGTAGCTCCGAACAGGAAGAGGACGAAAAAAATAACCGTCCGCGACGCCGA
HKR388034 RBd70B10 pGCAP10 NM_014764.2  
GGACACGGAAGTAGCTCCGAACAGGAAGAGGACGAAAAAAATAACCGTCCGCGACGCCGA
HKR396874 RBd92D02 pGCAP10 NM_014764.2  
GACTCGGGCGTCGGGTGACGCTAGGCGGACGGACCATCATGTGACACGGAAGTAGCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl