RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - TATDN2

Gene ID	NCBI Gene 9797 \| KEGG hsa:9797
Gene Symbol	TATDN2
Protein Name	TatD DNase domain containing 2
Synonyms	-

Ortholog resource in our bank

  TATDN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR180578	ARi51H10	pGCAP10	NM_014760.3
HKR180578	GGTCGCTCTCCGGCCTGCGGGCCGCAGGGCTCGTTCCGGAGGGCGGGCGCCACGGAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl