RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DHX38

Gene ID	NCBI Gene 9785 \| KEGG hsa:9785
Gene Symbol	DHX38
Protein Name	DEAH-box helicase 38
Synonyms	DDX38\|PRP16\|PRPF16\|RP84

Ortholog resource in our bank

  DHX38

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR388073	RBd70D01	pGCAP10	NM_014003.3
HKR388073	TGAATAATGGCCGCTTTCAAGGTGTGGATTTTGGCTCCTTGAGCCTGTCTGAGCGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl