Prev. |  KEGG KO K17929 > 

RIKEN DNA Bank Human Resource - SNX17

Gene ID NCBI Gene 9784 |  KEGG hsa:9784
Gene Symbol SNX17
Protein Name sorting nexin 17
Synonyms -
Ortholog resource in our bank

  SNX17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044195 IRAK110I03 pCMV-SPORT6 BC050590 NM_014748 Full
HGY081764 IRAL004G20 pOTB7 BC002524 NM_014748 Full
HGY081924 IRAL004N12 pOTB7 BC002610 NM_014748 Full
HGY084020 IRAL010A20 pOTB7 BC014620 NM_014748 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218172 ARiS045H04 pGCAP10 NM_014748.2  
GCCACATCGGATCGCAGGGCTCCCAAAATGGCGAGTGAGGCTGCGGGGACTCGCTGAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl