Prev. |  KEGG KO K22128 > 

RIKEN DNA Bank Human Resource - PIEZO1

Gene ID NCBI Gene 9780 |  KEGG hsa:9780
Gene Symbol PIEZO1
Protein Name piezo type mechanosensitive ion channel component 1
Synonyms DHS|FAM38A|LMPH3|LMPHM6|Mib
Ortholog resource in our bank

  PIEZO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395675 RBd89D03 pGCAP10 NM_001142864.2  
GATCCCAGACCTTATCGCCGGGCACAGAACTTCCAAGCCAGGGGAGAGGGAGGCCTGGAG
HKR398101 RBd95E05 pGCAP10 NM_001142864.2  
GATCCCAGACCTTATCGCCGGGCACAGAACTTCCAAGCCAGGGGAGAGGGAGGCCTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl