Prev. | 

RIKEN DNA Bank Human Resource - JADE3

Gene ID NCBI Gene 9767 |  KEGG hsa:9767
Gene Symbol JADE3
Protein Name jade family PHD finger 3
Synonyms JADE-3|PHF16
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082154 ARf05G10 pKA1U5 NM_014735.3 Full done
GGCCAGAAGAACGCGCGGCGGGCAGACGGCTGGGAGCCGCTCCGGATGCTCCAGGATGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl