Prev. |  KEGG KO K04679 > 

RIKEN DNA Bank Human Resource - ZFYVE16

Gene ID NCBI Gene 9765 |  KEGG hsa:9765
Gene Symbol ZFYVE16
Protein Name zinc finger FYVE-type containing 16
Synonyms PPP1R69
Ortholog resources KEGG ortholog (KEGG orthology K04679) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX019724 IRAK049F04 pCMV-SPORT6 BC032227 NM_014733 Partial/var
HGY094816 IRAL037A16 pDNR-LIB BC030808 NM_014733 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180154 ARi50G10 pGCAP10 NM_014733.3  
GGCGCTGCCCGGTGGGGCGGGGAAAGAAGCCCTGAGCCGGGATCTGGCACTCCCAGGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl