Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LAPTM4A

Gene ID (NCBI) 9741
Gene Symbol LAPTM4A
Protein Name lysosomal protein transmembrane 4 alpha
Synonyms HUMORF13|LAPTM4|MBNT|Mtrp
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080746 IRAL001O10 pOTB7 BC000421 NM_014713 Full
HGY083744 IRAL009F24 pOTB7 BC003158 NM_014713 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045657 W01A114C09 pENTR-TOPO IRAL009F24 BC003158 NM_014713  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163227 ARi08B03 pGCAP10 NM_014713.4  
CGGCCGGCCGATGGAAGCTGGCAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGT
HKR056808 ARe42A08 pKA1U5 NM_014713.4  
GAGCCGTTTGAGTTTGGCTGCGGGTGGAGAACGTTTGTCAGGGGCCCGGCCAAGAAGGAG
HKR184100 ARi60E04 pGCAP10 NM_014713.4  
GGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACA
HKR186979 ARi67H11 pGCAP10 NM_014713.4  
GGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACA
HKR073351 ARe83G07 pKA1U5 NM_014713.4  
GAGGCCGTGAAACAGCCGTTTGAGTTTGGCTGCGGGTGGAGAACGTTTGTCAGGGGCCCG
HKR074903 ARe87E07 pKA1U5 NM_014713.4  
GAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAA
HKR079371 ARe98H03 pKA1U5 NM_014713.4  
GGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACAGCCGTTTGAGTT
HKR235475 ARiS088L11 pGCAP10 NM_014713.4  
GAGCCGTTTGAGTTTGGCTGCGGGTGGAGAACGTTTGTCAGGGGCCCGGCCAAGAAGGAG
HKR387321 RBd68F01 pGCAP10 NM_014713.4  
GGTCCNTGGGTTTTGGAGGCCGTGAAACAGCCGTTTGAGTTTGGCTGCGGGTGGAGAACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl