Prev. |  KEGG KO K11409 > 

RIKEN DNA Bank Human Resource - HDAC9

Gene ID NCBI Gene 9734 |  KEGG hsa:9734
Gene Symbol HDAC9
Protein Name histone deacetylase 9
Synonyms HD7|HD7b|HD9|HDAC|HDAC7|HDAC7B|HDAC9B|HDAC9FL|HDRP|MITR
Ortholog resource in our bank

  HDAC9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066857 ARe67C09 pKA1U5 NM_058176.2 done
ATCCTGTGGTCAGCTACGATTTTCTCTAGCCTCAAGAAGACTGAGACCGAGCCAAACTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl