Prev. |  KEGG KO K14027 > 

RIKEN DNA Bank Human Resource - HERPUD1

Gene ID NCBI Gene 9709 |  KEGG hsa:9709
Gene Symbol HERPUD1
Protein Name homocysteine inducible ER protein with ubiquitin like domain 1
Synonyms HERP|Mif1|SUP
Ortholog resource in our bank

  HERPUD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027919 IRAK069N07 pCMV-SPORT6 BC032673 NM_014685 Full
HGY082861 IRAL007C13 pOTB7 BC000086 NM_014685 Full
HGY088619 IRAL021J03 pDNR-LIB BC009739 NM_014685 Full/var
HGY089131 IRAL022N19 pOTB7 BC008320 NM_014685 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010254 W01A025K14 pENTR-TOPO IRAL021J03 BC009739 NM_014685  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235175 ARiS087P15 pGCAP10 NM_014685.2  
GGCCCCAGAGACGTGAACGGTCGTTGCAGAGATTGCGGGCGGCTGANACGCCGCCTGCCT
HKR374057 RBd35C09 pGCAP10 NM_014685.2  
GGCCCCAGAGACGTGAACGGTCGTTGCAGAGATTGCGGGCGGCTGAGACGCCGCCTGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl