Prev. |  KEGG KO K16762 > 

RIKEN DNA Bank Human Resource - CEP57

Gene ID NCBI Gene 9702 |  KEGG hsa:9702
Gene Symbol CEP57
Protein Name centrosomal protein 57
Synonyms MVA2|PIG8|TSP57
Ortholog resource in our bank

  CEP57

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001893 IRAK004M05 pCMV-SPORT6 BC001233 NM_014679 Full
HGX005262 IRAK013C14 pCMV-SPORT6 BC009053 NM_014679 Partial/var
HGX032929 IRAK082F09 pCMV-SPORT6 BC039711 NM_014679 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091622 M01C029A22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091670 M01C029C22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091718 M01C029E22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091766 M01C029G22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091814 M01C029I22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091862 M01C029K22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091910 M01C029M22 pDONR221 MGC04-B11 BC001233 NM_014679  
HGE091958 M01C029O22 pDONR221 MGC04-B11 BC001233 NM_014679  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015519 W01A038N07 pENTR-TOPO IRAK004M05 BC001233 NM_014679  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173324 ARi33F04 pGCAP10 NM_014679.3  
GAGACGTCCGTTAGGACGTGTTGCCCTTTCTGTGTAAGCTGTGAGCGTAGGCGGCCCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl