Prev. |  KEGG KO K16469 > 

RIKEN DNA Bank Human Resource - CROCC

Gene ID NCBI Gene 9696 |  KEGG hsa:9696
Gene Symbol CROCC
Protein Name ciliary rootlet coiled-coil, rootletin
Synonyms ROLT|TAX1BP2
Ortholog resources KEGG ortholog (KEGG orthology K16469) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR327705 RBb19E09 pKA1U5 NM_014675.3  
ACAGCATCCTGGCTGTGGCGCGTGCTGACTGAGCTAGTTCTTGGGGTCCTGGAGAAGGGG
HKR406018 RBdS015A18 pGCAP10 NM_014675.3  
GAGGTGGAGCTGACACTAGAGACGGTTATCCAGACACTGGAGAGCAGCGTCCTGTGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl