Prev. |  KEGG KO K17655 > 

RIKEN DNA Bank Human Resource - PRORP

Gene ID NCBI Gene 9692 |  KEGG hsa:9692
Gene Symbol PRORP
Protein Name protein only RNase P catalytic subunit
Synonyms KIAA0391|MRPP3
Ortholog resource in our bank

  PRORP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019783 IRAK049H15 pCMV-SPORT6 BC032221 NM_014672
HGY042488 IRAK106D16 pBluescript BC044580 NM_014672 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092835 M01C032B11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE092883 M01C032D11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE092931 M01C032F11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE092979 M01C032H11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE093027 M01C032J11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE093075 M01C032L11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE093123 M01C032N11 pDONR221 MGC05-G06 BC032221 ENST00000250377  
HGE093171 M01C032P11 pDONR221 MGC05-G06 BC032221 ENST00000250377  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192009 ARi80A09 pGCAP10 NM_014672.2  
GCCTTTCCTGAGTCGTTGGCGCAGCTGACTCGCCACCTCCTCCCTCCTCGTCCCCCCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl