Prev. | 

RIKEN DNA Bank Human Resource - BZW1

Gene ID NCBI Gene 9689 |  KEGG hsa:9689
Gene Symbol BZW1
Protein Name basic leucine zipper and W2 domains 1
Synonyms BZAP45|Nbla10236
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082677 IRAL006L13 pOTB7 BC001804 NM_014670
HGY094322 IRAL035N10 pDNR-LIB BC026303 NM_014670 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097210 M01C043A10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097258 M01C043C10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097306 M01C043E10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097354 M01C043G10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097402 M01C043I10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097450 M01C043K10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097498 M01C043M10 pDONR221 MGC11-B05 BC001804 NM_014670  
HGE097546 M01C043O10 pDONR221 MGC11-B05 BC001804 NM_014670  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041280 ARe03D08 pKA1U5 NM_014670.2  
GGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTC
HKR050828 ARe27B04 pKA1U5 NM_014670.2  
GAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTCGC
HKR164572 ARi11H04 pGCAP10 NM_014670.2  
GGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTCGCCTTA
HKR184547 ARi61G03 pGCAP10 NM_014670.2  
GGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTC
HKR209457 ARiS023K17 pGCAP10 NM_014670.2  
GGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTC
HKR394149 RBd85G05 pGCAP10 NM_014670.2  
GAGTTCCGGTCGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTC
HKR397250 RBd93C02 pGCAP10 NM_014670.2  
GGCAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTC
HKR403135 RBdS007N23 pGCAP10 NM_014670.2  
GAGAGGAGACACCGCCGCAGTTGCCGGTACATCGGGGATTTCTGGCTCTTTCCTCTTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl