Prev. |  KEGG KO K14309 > 

RIKEN DNA Bank Human Resource - NUP93

Gene ID NCBI Gene 9688 |  KEGG hsa:9688
Gene Symbol NUP93
Protein Name nucleoporin 93
Synonyms NIC96
Ortholog resource in our bank

  NUP93

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR378036 RBd45B12 pGCAP10 NM_014669.3  
TGGCGGCCGCGTCCTCAAGCCGGCACCTGAGCGGCGGAGACGGCTGTAGCACAAGGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl