Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUP93

Gene ID (NCBI) 9688
Gene Symbol NUP93
Protein Name nucleoporin 93kDa
Synonyms NIC96
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14309)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR378036 RBd45B12 pGCAP10 NM_014669.3  
TGGCGGCCGCGTCCTCAAGCCGGCACCTGAGCGGCGGAGACGGCTGTAGCACAAGGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl