Prev. |  KEGG KO K13024 > 

RIKEN DNA Bank Human Resource - PPIP5K1

Gene ID NCBI Gene 9677 |  KEGG hsa:9677
Gene Symbol PPIP5K1
Protein Name diphosphoinositol pentakisphosphate kinase 1
Synonyms HISPPD2A|IP6K|IPS1|VIP1|hsVIP1
Ortholog resources KEGG ortholog (KEGG orthology K13024) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027226 IRAK068B02 pCMV-SPORT6 BC035611 -
HGX037516 IRAK093N04 pCMV-SPORT6 BC050263 -
HGX044228 IRAK110J12 pCMV-SPORT6 BC057395 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095235 M01C038B11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095283 M01C038D11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095331 M01C038F11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095379 M01C038H11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095427 M01C038J11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095475 M01C038L11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095523 M01C038N11 pDONR221 MGC08-G06 BC057395 NM_014659  
HGE095571 M01C038P11 pDONR221 MGC08-G06 BC057395 NM_014659  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR189249 ARi73C01 pGCAP10 NM_014659.4  
GGCCTGCAGGTTCGGCTGCGCGAGCGGAGGGAGGCGGAGCGGGATGAGTGGGTGTTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl