Prev. |  KEGG KO K10642 > 

RIKEN DNA Bank Human Resource - DZIP3

Gene ID NCBI Gene 9666 |  KEGG hsa:9666
Gene Symbol DZIP3
Protein Name DAZ interacting zinc finger protein 3
Synonyms PPP1R66|UURF2|hRUL138
Ortholog resource in our bank

  DZIP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033117 IRAK082N05 pCMV-SPORT6 BC039018 NM_014648 Partial/var
HGX056718 IRAK141N06 pCMV-SPORT6.1 BC063882 NM_014648
HGY099461 IRAL048K21 pDNR-LIB BC056674 NM_014648 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392555 RBd81G11 pGCAP10 NM_014648.2  
GGGGAGAGGAATCGGTTAGGAGAAGGGGGATTCCTCACTCAGCTGTGCGCTCTGATTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl