Prev. |  KEGG KO K16601 > 

RIKEN DNA Bank Human Resource - TTLL4

Gene ID NCBI Gene 9654 |  KEGG hsa:9654
Gene Symbol TTLL4
Protein Name tubulin tyrosine ligase like 4
Synonyms -
Ortholog resource in our bank

  TTLL4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013415 IRAK033I23 pBluescriptR BC021707 NM_014640 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089246 M01C023B22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089294 M01C023D22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089342 M01C023F22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089390 M01C023H22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089438 M01C023J22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089486 M01C023L22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089534 M01C023N22 pDONR221 MGC01-D11 BC021707 ENST00000258398  
HGE089582 M01C023P22 pDONR221 MGC01-D11 BC021707 ENST00000258398  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR335298 RBb38E02 pGCAP1 NM_014640.3  
GCTGTCCGCTGGGGGCGCGCGCGGTGATGTGGCAGGCGGCAGCGGCGCTGGCGGCCGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl