Prev. |  KEGG KO K19006 > 

RIKEN DNA Bank Human Resource - PLCH2

Gene ID NCBI Gene 9651 |  KEGG hsa:9651
Gene Symbol PLCH2
Protein Name phospholipase C eta 2
Synonyms PLC-L4|PLC-eta2|PLCL4|PLCeta2
Ortholog resources KEGG ortholog (KEGG orthology K19006) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011820 IRAK029J04 pCMV-SPORT6 BC050037 NM_014638 Partial
HGX011925 IRAK029N13 pCMV-SPORT6 BC019679 NM_014638 Partial
HGX034836 IRAK087B12 pCMV-SPORT6 BC043358 NM_014638 Partial/var
HGY097612 IRAL044A12 pOTB7 BC044630 NM_014638 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386121 RBd65F01 pGCAP10 NM_014638.2  
GGCTCAGCACACCTCGGTCTCCCAGGCACCTGCAGGGCCTGGGGGCTGAACCCAAGGGGG
HKR406292 RBdS015M04 pGCAP10 NM_014638.2  
TGAGGGATTCCTTGGTGGCCCTGGAGGGTGGATAGGCTGGCCTGGGGGCCATCAGGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl