Prev. |  KEGG KO K02835 > 

RIKEN DNA Bank Human Resource - MTRF1

Gene ID NCBI Gene 9617 |  KEGG hsa:9617
Gene Symbol MTRF1
Protein Name mitochondrial translation release factor 1
Synonyms MRF1|MTTRF1|RF1
Ortholog resource in our bank

  MTRF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032898 IRAK082E02 pCMV-SPORT6 BC042196 NM_004294 Full
HGX054180 IRAK135H12 pCMV-SPORT6 BC065496 NM_004294 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395235 RBd88B11 pGCAP10 NM_004294.2  
GGATCTCGGGTTTGTCGGGCTGAAATGTGGCGGGTCTCGGAAGGTTCCGACCTCAGTAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl