Prev. |  KEGG KO K10611 > 

RIKEN DNA Bank Human Resource - RNF7

Gene ID NCBI Gene 9616 |  KEGG hsa:9616
Gene Symbol RNF7
Protein Name ring finger protein 7
Synonyms CKBBP1|ROC2|SAG
Ortholog resources KEGG ortholog (KEGG orthology K10611) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004982 IRAK012H14 pCMV-SPORT6 BC008627 NM_014245 Full
HGY088749 IRAL021O13 pDNR-LIB BC005966 NM_014245 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE039855 W01A099K15 pENTR-TOPO IRAL021O13 BC005966 NM_014245  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070970 ARe77H02 pKA1U5 NM_014245.3  
GGGCTCCGCGGCGCCGCCATGGCCGACGTGGCACCANTNGAGAGGAAACCTGCGCCCTGG
HKR074897 ARe87E01 pKA1U5 NM_014245.3  
GGGCTCCGCGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCC
HKR375604 RBd39A04 pGCAP10 NM_014245.3  
GGCGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCAC
HKR432761 RBdS081P01 pGCAP10 NM_014245.3  
GGCCGCCATGGCCGACGTGNAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl