Prev. |  KEGG KO K11188 > 

RIKEN DNA Bank Human Resource - PRDX6

Gene ID NCBI Gene 9588 |  KEGG hsa:9588
Gene Symbol PRDX6
Protein Name peroxiredoxin 6
Synonyms 1-Cys|AOP2|HEL-S-128m|NSGPx|PRX|aiPLA2|p29
Ortholog resources KEGG ortholog (KEGG orthology K11188) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031972 IRAK079P12 pCMV-SPORT6 BC035857 NM_004905 Full
HGX046215 IRAK115I23 pCMV-SPORT6 BC053550 NM_004905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095602 M01C039A02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095650 M01C039C02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095698 M01C039E02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095746 M01C039G02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095794 M01C039I02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095842 M01C039K02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095890 M01C039M02 pDONR221 MGC09-B01 BC053550 NM_004905  
HGE095938 M01C039O02 pDONR221 MGC09-B01 BC053550 NM_004905  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045466 W01A113L02 pENTR-TOPO IRAK079P12 BC035857 NM_004905  
HGE045468 W01A113L04 pENTR-TOPO IRAK079P12 BC035857 NM_004905  
HGE045474 W01A113L10 pENTR-TOPO IRAK079P12 BC035857 NM_004905  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042831 ARe07B07 pKA1U5 NM_004905.2  
GGCTGTTCCCAGCGGCGCCCCCTCATCACCGTCGCCATGCCCGGAGGTCTGCTTCTCGGG
HKR050027 ARe25B03 pKA1U5 NM_004905.2  
GGCTTCTTCGCCAGNAACCAACCGGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACC
HKR058430 ARe46B06 pKA1U5 NM_004905.2  
ATCCTGATCACCGNTCGCCATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTT
HKR078179 ARe95H11 pKA1U5 NM_004905.2  
GGNNTCTTCGCCNGAACCAACCGGTTGNTTGCTNCTCTNAGCGGCGCCCCCTCATCNNCG
HKR172547 ARi31G03 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR173706 ARi34E10 pGCAP10 NM_004905.2  
GGGCCCCGCCCCCGCCGCCCCAGTCCCCGCCCCTCGCGCCTTCGTTTATTCCTCCGCGCG
HKR178405 ARi46A05 pGCAP10 NM_004905.2  
TTTTTTGGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCAT
HKR320573 RBb01H05 pKA1U5 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR323379 RBb08H11 pKA1U5 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCNGTTTNCAGCGGCGCCCCCTCATCACCG
HKR346802 RBb67A02 pGCAP1 NM_004905.2  
GGCTGTCCCAGCGGCGCCCCCTCATCACCGTCGCCATGCCCGGAGGTCTGCTTCTCGGGG
HKR347369 RBb68H01 pGCAP1 NM_004905.2  
GGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGTCGCCATGC
HKR361630 RBd04B06 pGCAP10 NM_004905.2  
GGCGCCCCCTCATCACCGTCGCCATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCA
HKR370499 RBd26E03 pGCAP10 NM_004905.2  
GGCCTTCGTTTATTCCTCCGCGCGCTGGGACAGGCTGCTTCTTCGCCAGAACCAACCGGT
HKR376979 RBd42H11 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR382032 RBd55B08 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCNNNNTNNCNNCATCACCGT
HKR385257 RBd63C09 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR388850 RBd72C02 pGCAP10 NM_004905.2  
GTTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGTC
HKR394060 RBd85C12 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR405632 RBdS014B08 pGCAP10 NM_004905.2  
GGCTTCTTCGCCAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGT
HKR430191 RBdS075H23 pGCAP10 NM_004905.2  
ATCACCGTCGCCATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCC
HKR441879 RBdS104L15 pGCAP10 NM_004905.2  
GAGAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGTCGCCATGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl