Prev. |  KEGG KO K12305 > 

RIKEN DNA Bank Human Resource - ENTPD4

Gene ID NCBI Gene 9583 |  KEGG hsa:9583
Gene Symbol ENTPD4
Protein Name ectonucleoside triphosphate diphosphohydrolase 4
Synonyms LALP70|LAP70|LYSAL1|NTPDase-4|UDPase
Featured content Lysosome (human)
Ortholog resource in our bank

  ENTPD4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013406 IRAK033I14 pBluescriptR BC034477 NM_004901 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056523 ARe41F03 pKA1U5 NM_004901.2  
GGCGGCCTCCAGGAAGCCGGCTGGCCGTGATGCTGCCCACTGGTGGTCCCCCGCTCCCGG
HKR186004 ARi65A04 pGCAP10 NM_004901.2  
GGTGTTGCCGGCGGGGGCCGGGCGGGGGTGCGGCTCCAGGAAAGGAGCGCGGCCTCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl