Prev. | 

RIKEN DNA Bank Human Resource - PREPL

Gene ID NCBI Gene 9581 |  KEGG hsa:9581
Gene Symbol PREPL
Protein Name prolyl endopeptidase like
Synonyms CMS22
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105230 M01C063B06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105278 M01C063D06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105326 M01C063F06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105374 M01C063H06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105422 M01C063J06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105470 M01C063L06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105518 M01C063N06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE105566 M01C063P06 pDONR221 06_06-D03 AK131463 NM_006036  
HGE124411 M01C111A11 pDONR221 06-2_04-A06 AK131463 NM_006036  
HGE124459 M01C111C11 pDONR221 06-2_04-A06 AK131463 NM_006036  
HGE124507 M01C111E11 pDONR221 06-2_04-A06 AK131463 NM_006036  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234036 ARiS085B12 pGCAP10 NM_006036.3  
GGCAAACCAGCTCTAGGCGGCTCTGGGTAAGTTGTCGTTCTGTGGGCTGCGGAACGCAGA
HKR380428 RBd51B04 pGCAP10 NM_006036.3  
GGCAGACTTCGGCTGGACTTGCCTGCGGTGACACCTGCTCCCCTCTGAGAGCTTCAGGTT
HKR430357 RBdS075O21 pGCAP10 NM_006036.3  
GAGACTTCGGCTGGACTTGCCTGCGGTGACACCTGCTCCCCTCTGAGAGCTTCAGGTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl