Prev. |  KEGG KO K03121 > 

RIKEN DNA Bank Human Resource - GTF2IRD1

Gene ID NCBI Gene 9569 |  KEGG hsa:9569
Gene Symbol GTF2IRD1
Protein Name GTF2I repeat domain containing 1
Synonyms BEN|CREAM1|GTF3|MUSTRD1|RBAP2|WBS|WBSCR11|WBSCR12|hMusTRD1alpha1
Ortholog resources KEGG ortholog (KEGG orthology K03121) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009071 IRAK022L07 pCMV-SPORT6 BC018136 NM_016328 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR433327 RBdS083F07 pGCAP10 NM_005685.2  
GGATTAATTAAGGAGGCAGCGGCAGGAGGCTGAGTCCTGGCCGCGGGCCGGGGCCGGGGC
HKR433485 RBdS083L21 pGCAP10 NM_005685.2  
GGCCCTCCGCCGCANCCCGCGCCGGGGGTGGGGGCCGCCGAGCGCNNCNTCATNACNNNG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl