Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AFY

Gene ID NCBI Gene 9555 |  KEGG hsa:9555
Gene Symbol H2AFY
Protein Name H2A histone family member Y
Synonyms H2A.y|H2A/y|H2AF12M|MACROH2A1.1|mH2A1|macroH2A1.2
Ortholog resources KEGG ortholog (KEGG orthology K11251) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042478 IRAK106D06 pBluescript BC045570 NM_138610 Partial/var
HGY087692 IRAL019D20 pDNR-LIB BC013331 NM_138610 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006373 W01A015P13 pENTR-TOPO IRAL019D20 BC013331 NM_138610  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060002 ARe50A02 pKA1U5 NM_004893.2  
GGGGAAGCCGGCCGCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGG
HKR264471 ARiS161C23 pGCAP10 NM_004893.2  
GCCAGTTCACTCNGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGA
HKR320829 RBb02B05 pKA1U5 NM_004893.2  
GGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGC
HKR330123 RBb25F03 pGCAP1 NM_004893.2  
GTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGA
HKR367345 RBd18G01 pGCAP10 NM_004893.2  
GGCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGC
HKR372974 RBd32H06 pGCAP10 NM_004893.2  
GGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAA
HKR386032 RBd65B08 pGCAP10 NM_004893.2  
GGANAGNNNGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGG
HKR390402 RBd76A02 pGCAP10 NM_004893.2  
GGAGGGGGNNAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGA
HKR392149 RBd80G05 pGCAP10 NM_004893.2  
GGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGC
HKR409029 RBdS022J13 pGCAP10 NM_004893.2  
GGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCC
HKR428084 RBdS070D12 pGCAP10 NM_004893.2  
GATTGTGGGAAGCCGGCCGCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGG
HKR428133 RBdS070F13 pGCAP10 NM_004893.2  
GATTGTGGNAANNCGGCCGCNANGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGG
HKR442124 RBdS105F04 pGCAP10 NM_004893.2  
GATCCTGTGTGACCTTTGGTTAAATGAATCAGCCTCTCTGCCCTGGTCTGCCTTATCAGC
HKR471144 RBdS177O08 pGCAP10 NM_004893.2  
GGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl