Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V1G1

Gene ID (NCBI) 9550
Gene Symbol ATP6V1G1
Protein Name ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Synonyms ATP6G|ATP6G1|ATP6GL|ATP6J|Vma10
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02152)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY088690 IRAL021M02 pDNR-LIB BC008452 NM_004888 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072921 ARe82F01 pKA1U5 NM_004888.3  
TTGGACCCAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAATCGCTGC
HKR218133 ARiS045F13 pGCAP10 NM_004888.3  
GAGCTGACCCNNGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCANAATCGCT
HKR322055 RBb05C07 pKA1U5 NM_004888.3  
GAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAATCGCTGCCGCCATG
HKR362923 RBd07F03 pGCAP10 NM_004888.3  
GAGGCCGCTTGCCTTGCTCTCAGAATCGCTGCCGCCATGGCTAGTCAGTCTCAGGGGATT
HKR336411 RBb41A11 pGCAP1 NM_004888.3  
GGTCAGCTGACCCAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAATC
HKR383606 RBd59A06 pGCAP10 NM_004888.3  
TGAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAATCGCTGCCGCCAT
HKR383776 RBd59H08 pGCAP10 NM_004888.3  
GGAGGNGTGNGGGAGGGCGCTAGCTCCGCGGGACCTCATCCCCCGGGAGAGGCCCGGATG
HKR389746 RBd74G02 pGCAP10 NM_004888.3  
GGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAATCGCTGCCGCCATGGCT
HKR395729 RBd89F09 pGCAP10 NM_004888.3  
GGTGGGCGGCTGTGTCAGCTGACCCAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTT
HKR399749 RBd99G05 pGCAP10 NM_004888.3  
GTGTCAGCTGACCCAAGGGGCCTTCGAGGTGCCTTAGGCCGCTTGCCTTGCTCTCAGAAT
HKR442221 RBdS105J05 pGCAP10 NM_004888.3  
GGCCTTAGGCCGCTTGCCTTGCTCTCAGAATCGCTGCCGCCATGGCTAGTCAGTCTCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl