Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EI24

Gene ID (NCBI) 9538
Gene Symbol EI24
Protein Name etoposide induced 2.4
Synonyms EPG4|PIG8|TP53I8
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10134)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080434 IRAL001B10 pOTB7 BC002390 NM_004879 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049754 ARe24G10 pKA1U5 NM_004879.3  
GGGAGCTGGCCCGCGGTGGGCTAGGGGCAGGGCCGGAGCCGCGGCGGCGGAGCTGTGGAT
HKR184052 ARi60C04 pGCAP10 NM_004879.3  
GAGTGCGGGCGCAGCGGCCCCGGCCCTGGAAGCGCCCCGGCGGAGCTGGCCTGCGGTGGG
HKR069301 ARe73E05 pKA1U5 NM_004879.3  
GGGGCATGCCCAGTTGCGGGCGCAGCNGNNCCCGCCCCNTNAAAAGCGCCCCGGNCGGNA
HKR343625 RBb59B01 pGCAP1 NM_004879.3  
GCCAGCGGCCCCGTGCGGCCCGGGCATGCCCAGTGCGGGCGCAGCGGCCCCGGCCCTGGA
HKR383658 RBd59C10 pGCAP10 NM_004879.3  
GAGTGCGGGCGCAGCGGCCCCGGCCCTGGAAGCGCCCCGGCGGAGCTGGCCCGCGGTGGG
HKR388078 RBd70D06 pGCAP10 NM_004879.3  
GGTGCGGGCGCAGCGGCCCCGGCCCTGGAAGCGCCCCGGCGGAGCTGGCCCGCGGTGGGC
HKR389211 RBd73A11 pGCAP10 NM_004879.3  
GGCAGCNNNNCCGGCCCTGGAAGCGCCCCGGCGGAGCTGGCCCGCGGTGGGCTAGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl