Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BAG2

Gene ID (NCBI) 9532
Gene Symbol BAG2
Protein Name BCL2 associated athanogene 2
Synonyms BAG-2|dJ417I1.2
Databases KEGG hsa:9532 |  NCBI Gene 9532
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09556)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174874 ARi37D02 pGCAP10 NM_004282.3  
GGTTCCTGGGTCCGGGGAGCAGACGATCCGCTAGCCACATTAGGCGCTCGGTCTCTGCGT
HKR208312 ARiS020M24 pGCAP10 NM_004282.3  
GCCACTCGCTGCCGCCGGAGGGGCCGGTGACCTCTTGGCTACCCCGCGTCGGAGGCTTAG
HKR218223 ARiS045J07 pGCAP10 NM_004282.3  
GGCTCCACTCNCTGCCGCCGGAGGGGCCGGTGACCTCTTGGCTACCCCGCGTCGGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl