Prev. |  KEGG KO K09556 > 

RIKEN DNA Bank Human Resource - BAG2

Gene ID NCBI Gene 9532 |  KEGG hsa:9532
Gene Symbol BAG2
Protein Name BAG cochaperone 2
Synonyms BAG-2|dJ417I1.2
Ortholog resources KEGG ortholog (KEGG orthology K09556) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174874 ARi37D02 pGCAP10 NM_004282.3  
GGTTCCTGGGTCCGGGGAGCAGACGATCCGCTAGCCACATTAGGCGCTCGGTCTCTGCGT
HKR208312 ARiS020M24 pGCAP10 NM_004282.3  
GCCACTCGCTGCCGCCGGAGGGGCCGGTGACCTCTTGGCTACCCCGCGTCGGAGGCTTAG
HKR218223 ARiS045J07 pGCAP10 NM_004282.3  
GGCTCCACTCNCTGCCGCCGGAGGGGCCGGTGACCTCTTGGCTACCCCGCGTCGGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl