Prev. |  KEGG KO K19995 > 

RIKEN DNA Bank Human Resource - SCAMP1

Gene ID NCBI Gene 9522 |  KEGG hsa:9522
Gene Symbol SCAMP1
Protein Name secretory carrier membrane protein 1
Synonyms SCAMP|SCAMP37
Ortholog resource in our bank

  SCAMP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013081 IRAK032L17 pBluescriptR BC034048 NM_052822 Full
HGY087739 IRAL019F19 pDNR-LIB BC015065 NM_052822 Full
HGY092997 IRAL032I05 pDNR-LIB BC016355 NM_004866 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019498 W01A048M10 pENTR-TOPO IRAL019F19 BC015065 NM_052822  
HGE019500 W01A048M12 pENTR-TOPO IRAL019F19 BC015065 NM_052822  
HGE019502 W01A048M14 pENTR-TOPO IRAL019F19 BC015065 NM_052822  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323378 RBb08H10 pKA1U5 NM_004866.4  
GGGCGGCGGCGACGTGAGCGCGCAGGGGGGCGGCGGCCTCGCCTCGTCTCTCTCTCTGCG
HKR373754 RBd34G10 pGCAP10 NM_004866.4  
GAGAGAGATGTCGGATTTCGACAGTAACCCGTTTGCCGACCCGGATCTCAACAATCCCTT
HKR398826 RBd97B02 pGCAP10 NM_004866.4  
GGGCACTGCTCCCGGGGTGCGCGGCCCACGACTCAGGCTGCCTCCCCCAACCTGACAAGT
HKR461938 RBdS154O02 pGCAP10 NM_004866.4  
GGCCTCGTCTCTCTCTCTGCGCCTGGGTCGGGTGGGTGACGCCGAGAGCCAGAGAGATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl