Prev. |  KEGG KO K19363 > 

RIKEN DNA Bank Human Resource - LITAF

Gene ID NCBI Gene 9516 |  KEGG hsa:9516
Gene Symbol LITAF
Protein Name lipopolysaccharide induced TNF factor
Synonyms PIG7|SIMPLE|TP53I7
Ortholog resources KEGG ortholog (KEGG orthology K19363) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166549 ARi16G05 pGCAP10 NM_004862.3  
GGGACGGGTGGGGCTGGCACCGAGAGGCAGGGGCAGGATAGGAGAGTCGGGGAGACACCA
HKR168579 ARi21H11 pGCAP10 NM_004862.3  
GAGACCTCCCGGCTCGACAGGCGGCGCGGGCGGCGGTAAAATGTCGGTTCCAGGACCTTA
HKR238562 ARiS096G18 pGCAP10 NM_004862.3  
GGGCGGACGGGTGGGGCTGGCACCGAGAGGCAGGGGCAGGATAGGAGAGTGGGGGAGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl