Prev. |  KEGG KO K15516 > 

RIKEN DNA Bank Human Resource - FXR2

Gene ID NCBI Gene 9513 |  KEGG hsa:9513
Gene Symbol FXR2
Protein Name FMR1 autosomal homolog 2
Synonyms FMR1L2|FXR2P
Ortholog resources KEGG ortholog (KEGG orthology K15516) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010744 IRAK026O08 pCMV-SPORT6 BC020090 NM_004860 Full/var
HGX044255 IRAK110K15 pCMV-SPORT6 BC051907 NM_004860 Full/var
HGX056592 IRAK141H24 pCMV-SPORT6 BC067272 NM_004860 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002956 W01A007G12 pENTR-TOPO IRAK026O08 BC020090 NM_004860  
HGE002958 W01A007G14 pENTR-TOPO IRAK026O08 BC020090 NM_004860  
HGE034222 W01A085J06 pENTR-TOPO IRAK141H24 BC067272 NM_004860  
HGE034234 W01A085J18 pENTR-TOPO IRAK141H24 BC067272 NM_004860  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362036 RBd05B12 pGCAP10 NM_004860.2  
GGGCAGGGGGAGGTGGAGGCTGTGGAGCGGCAGCGGCAGCAGCGGGTCCCGGGACTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl