Prev. |  KEGG KO K17732 > 

RIKEN DNA Bank Human Resource - PMPCB

Gene ID NCBI Gene 9512 |  KEGG hsa:9512
Gene Symbol PMPCB
Protein Name peptidase, mitochondrial processing beta subunit
Synonyms Beta-MPP|MPP11|MPPB|MPPP52|P-52
Ortholog resources KEGG ortholog (KEGG orthology K17732) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087918 IRAL019N06 pDNR-LIB BC010398 NM_004279 Full/var
HGY091466 IRAL028L02 pOTB7 BC014079 NM_004279 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249165 ARiS122P05 pGCAP10 NM_004279.2  
AGAAATGGCGGCTGCGGCGGCTCGAGTGGTGTTGTCATCCGCGGCGCGGCGGCGGCTCTG
HKR333628 RBb34B04 pGCAP1 NM_004279.2  
AATGTGAGCAGAAATGGCGGCTGCGGCGGCTCGAGTGGTGTTGTCATCCGCGGCGCGGCG
HKR333698 RBb34E02 pGCAP1 NM_004279.2  
AAATGTGAGCAGAAATGGCGGCTGCGGCGGCTCGAGTGGTGTTGTCATCCGCGGCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl