Prev. |  KEGG KO K08618 > 

RIKEN DNA Bank Human Resource - ADAMTS2

Gene ID NCBI Gene 9509 |  KEGG hsa:9509
Gene Symbol ADAMTS2
Protein Name ADAM metallopeptidase with thrombospondin type 1 motif 2
Synonyms ADAM-TS2|ADAMTS-2|ADAMTS-3|EDSDERMS|NPI|PC I-NP|PCI-NP|PCINP|PCPNI|PNPI
Ortholog resources KEGG ortholog (KEGG orthology K08618) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052057 ARe30C09 pKA1U5 NM_014244.2  
AGCCCGCCTTCCCTCCGCGCTCCCCCGCCCGCCCCTCCGCGCCTCGCCTCCTCCGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl