Prev. |  KEGG KO K12464 > 

RIKEN DNA Bank Human Resource - MAGED1

Gene ID NCBI Gene 9500 |  KEGG hsa:9500
Gene Symbol MAGED1
Protein Name MAGE family member D1
Synonyms DLXIN-1|NRAGE
Ortholog resource in our bank

  MAGED1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025874 IRAK064L10 pCMV-SPORT6 BC032473 NM_006986 Full
HGY091376 IRAL028H08 pOTB7 BC014070 NM_001005333 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009883 W01A024L19 pENTR-TOPO IRAL028H08 BC014070 NM_001005333  
HGE009887 W01A024L23 pENTR-TOPO IRAL028H08 BC014070 NM_001005333  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067678 ARe69D06 pKA1U5 NM_001005333.1  
GCTGGACAAGGAGAGAGTGCGGCTGCTGAGAGCCGAGCCCAGCAATCCCGATCCTCTGAG
HKR279331 ARiS198F11 pGCAP10 NM_001005333.1  
TGAGCTGCCGCGCTGGCATTTTCTCCTGGACAAGGAGAGAGTGCGGCTGCTGAGAGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl