Prev. |  KEGG KO K08501 > 

RIKEN DNA Bank Human Resource - STX8

Gene ID NCBI Gene 9482 |  KEGG hsa:9482
Gene Symbol STX8
Protein Name syntaxin 8
Synonyms CARB
Ortholog resource in our bank

  STX8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005872 IRAK014L08 pCMV-SPORT6 BC009713 NM_004853 Full
HGY094067 IRAL035C19 pDNR-LIB BC020924 NM_004853

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021446 W01A053K06 pENTR-TOPO IRAK014L08 BC009713 NM_004853  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238672 ARiS096L08 pGCAP10 NM_004853.1  
GGAGCGGCGGGCGGAGTCTGCAGGATGGCACCGGACCCCTGGTTCTCCACATACGATTCT
HKR249105 ARiS122M17 pGCAP10 NM_004853.1  
GGGAGTCTGCAGGATGGCACCGGACCCCTGGTTCTCCACATACGATTCTACTTGTCAAAT
HKR405973 RBdS014P13 pGCAP10 NM_004853.1  
GGAGTCCGAGCGGCGGGCGGAGTCTGCAGGATGGCACCGGACCCCTGGTTCTCCACATAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl