Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATG5

Gene ID (NCBI) 9474
Gene Symbol ATG5
Protein Name autophagy related 5
Synonyms APG5|APG5-LIKE|APG5L|ASP|hAPG5
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Autophagy (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08339)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085153 IRAL012O17 pOTB7 BC002699 NM_004849 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059372 ARe48H04 pKA1U5 NM_004849.2  
GAGTCCTGCTACCGCGNTCCCCGCAGGACAGTGTGTCAGGCGGGCAGCTTGCCCCGCCGC
HKR374978 RBd37H10 pGCAP10 NM_004849.2  
GGCGGGCTTCCTGGAGTCCTGCTACCGCGTCCCCGCAGGACAGTGTGTCAGGCGGGCAGC
HKR382507 RBd56E11 pGCAP10 NM_004849.2  
GGTGTCAGGCGGGCAGCTTGCCCCGCCGCCCCACCGGAGCGCGGNATCTGGGCGTCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl