DNA Bank Top |  KEGG KO K08339 > 

RIKEN DNA Bank Human Resource - ATG5

Gene ID NCBI Gene 9474 |  KEGG hsa:9474
Gene Symbol ATG5
Protein Name autophagy related 5
Synonyms APG5|APG5-LIKE|APG5L|ASP|SCAR25|hAPG5
Featured content Autophagy (human)
Featured content Mitophagy - human
Featured content Ferroptosis - human

Link

Ortholog resource in our bank

  ATG5


External database

human ATG5

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19799 pCI-neo-hApg5(K130R)-HA Expression vector of human Apg5 mutant (K130R) with C-terminal HA.    
RDB19775 pCI-neo-hApg5-HA Expression vector of human Apg5 with C-terminal HA.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085153 IRAL012O17 pOTB7 BC002699 NM_004849 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059372 ARe48H04 pKA1U5 NM_004849.2  
GAGTCCTGCTACCGCGNTCCCCGCAGGACAGTGTGTCAGGCGGGCAGCTTGCCCCGCCGC
HKR374978 RBd37H10 pGCAP10 NM_004849.2  
GGCGGGCTTCCTGGAGTCCTGCTACCGCGTCCCCGCAGGACAGTGTGTCAGGCGGGCAGC
HKR382507 RBd56E11 pGCAP10 NM_004849.2  
GGTGTCAGGCGGGCAGCTTGCCCCGCCGCCCCACCGGAGCGCGGNATCTGGGCGTCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl