Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF4E2

Gene ID (NCBI) 9470
Gene Symbol EIF4E2
Protein Name eukaryotic translation initiation factor 4E family member 2
Synonyms 4E-LP|4EHP|EIF4EL3|IF4e
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080751 IRAL001O15 pOTB7 BC000360 NM_004846 Full/var
HGY084081 IRAL010D09 pOTB7 BC005874 NM_004846 Full
HGY086434 IRAL016B10 pDNR-LIB BC005392 NM_004846 Full
HGY087114 IRAL017N02 pOTB7 BC021226 NM_004846 Full
HGY092614 IRAL031I22 pDNR-LIB BC021690 NM_004846 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080524 ARf01F04 pKA1U5 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR055233 ARe38B09 pKA1U5 NM_004846.2  
GCCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAA
HKR180530 ARi51F10 pGCAP10 NM_004846.2  
GGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGAT
HKR064949 ARe62G05 pKA1U5 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR079208 ARe98A08 pKA1U5 NM_004846.2  
ATCCTGGACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGA
HKR205270 ARiS013C22 pGCAP10 NM_004846.2  
GGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGAT
HKR364147 RBd10G03 pGCAP10 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR371656 RBd29C08 pGCAP10 NM_004846.2  
GACTGCCTGCGGCTTCGGTTTTTCTCTTCGTTAGATGATGACTCACGGCTCTCACGCTTC
HKR376851 RBd42C03 pGCAP10 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR384171 RBd60H03 pGCAP10 NM_004846.2  
GAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGA
HKR390854 RBd77C06 pGCAP10 NM_004846.2  
GGAGGGACCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl