Prev. |  KEGG KO K03259 > 

RIKEN DNA Bank Human Resource - EIF4E2

Gene ID NCBI Gene 9470 |  KEGG hsa:9470
Gene Symbol EIF4E2
Protein Name eukaryotic translation initiation factor 4E family member 2
Synonyms 4E-LP|4EHP|EIF4EL3|IF4e|h4EHP
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  EIF4E2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080751 IRAL001O15 pOTB7 BC000360 NM_004846 Full/var
HGY084081 IRAL010D09 pOTB7 BC005874 NM_004846 Full
HGY086434 IRAL016B10 pDNR-LIB BC005392 NM_004846 Full
HGY087114 IRAL017N02 pOTB7 BC021226 NM_004846 Full
HGY092614 IRAL031I22 pDNR-LIB BC021690 NM_004846 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055233 ARe38B09 pKA1U5 NM_004846.2  
GCCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAA
HKR064949 ARe62G05 pKA1U5 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR079208 ARe98A08 pKA1U5 NM_004846.2  
ATCCTGGACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGA
HKR080524 ARf01F04 pKA1U5 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR180530 ARi51F10 pGCAP10 NM_004846.2  
GGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGAT
HKR205270 ARiS013C22 pGCAP10 NM_004846.2  
GGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGAT
HKR364147 RBd10G03 pGCAP10 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR371656 RBd29C08 pGCAP10 NM_004846.2  
GACTGCCTGCGGCTTCGGTTTTTCTCTTCGTTAGATGATGACTCACGGCTCTCACGCTTC
HKR376851 RBd42C03 pGCAP10 NM_004846.2  
GACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTT
HKR384171 RBd60H03 pGCAP10 NM_004846.2  
GAGCGGCGGCGAGAGGATGAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGA
HKR390854 RBd77C06 pGCAP10 NM_004846.2  
GGAGGGACCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl